The proPE Planner is an intuitive interface for the rational design of engRNA and tpgRNA
sequences to facilitate precise modifications using proPE, a prime editing tool described in
the publication “ProPE expands the prime editing window and enhances gene editing efficiency
where prime editing is inefficient” by Krausz et al..
How to use
Valid input criteria
min 140 nt + edit + min 140 nt
Edits can be substitutions, deletions, insertions, or their combinations, and don't need to
be continuous.
Example inputs
Replacement: G to C edit '(G/C)'
TTTGAAACAAGCACCGTGGGGCCTTTGAGTCATAGTCGTGTAGCGAGAAAGCGTATGCTATTACGAGGCAACGGATGGAGGTTTGTTCGTTGCCGTTCAGAGGGAATGGCTCGCCACTGAGACCGCGTACGGTGTGAGTACATCCGAGTA(G/C)ATGTATCCGAGGCTGTGTACTACAAACCTAGCTTCGAACAAAGTGCATAAGGCTGAGCTTGGAGATAAAACATCATAAGATATTCCACCACCCAATCTTTTGGACTAGCCAGACCCCCTATCCACGTTCATTGCTACAACCGATCCGCTT
Deletion: G deletion edit '(-G)'
TCAAAGTCCCCGACACCTTCCAACCCTCATCCTGAACCAGCTCTATGACCGATCTAAATTGCTACTTCGTCGCGACAGTCCGCATCGCAGGCGGGTCGCTGTACGGTGTTTTGGCGACCATCAGTAAATGGTTCTATTATCCTCGGAATG(-G)CAACTGCATCGTACTCGCGTTAGCTTATTATTTAAAGAGGAGCGTTCCAGACCGAAGGGAGGATCGCCGGGATTTGATACTAGTTAAGACTCTCGAAATCTACATCCTCAGTTATTCTCCATCCGCCTACCCGAGATTAACACCCGACAA
Insertion: T insertion edit '(+T)'
AAATACGCGAGTGGACAAGTGCCCTGTGGTCGTGGTCGCAACTTGAGACAATTGGTTAGCCGTTGAGCGTCTTGATGGGACGAGTTGGCCACTCGGTATTTTAACGGCTCTGACGTTGGTACACAGCTTATATATGCTGGTCCGTGTGGT(+T)GATAGTCGGTTTGAATAGCCTACATCCCGTATTAACCATCACCGAGCCCCTTTACCCTGTGGCCCAATCTGCATTGAGAAATAGTCGTCGAAATGTAATCTATTAGACCTTGGACGGTTTACGAAAGCCCGACTCAGACGTCTGATGGCA
Multi-edit
AAATACGCGAGTGGACAAGTGCCCTGTGGTCGTGGTCGCAACTTGAGACAATTGGTTAGCCGTTGAGCGTCTTGATGGGACGAGTTGGCCACTCGGTATTTTAACGGCTCTGACGTTGGTACACAGCTTATATATGCTGGTCCGTGTGGT(+T)GATA(G/CTT)GTCGGTT(-GG)TGAATAGCCTACATCCCGTATTAACCATCACCGAGCCCCTTTACCCTGTGGCCCAATCTGCATTGAGAAATAGTCGTCGAAATGTAATCTATTAGACCTTGGACGGTTTACGAAAGCCCGACTCAGACGTCTGATGGCAGTTTACGAAAGCCCGACTCAGACGTCTGATGGCA
About the results
The planner outputs the spacers of engRNA–tpgRNA pairs, where targets are chosen by rational
design rules. For each pair, it also suggests the RTT and PBS sequences at the 3′ end of the
tpgRNA to achieve the requested edit.
Spacers
Targets for the engRNA–tpgRNA spacer pairs are ranked (1 = best) based on:
- the edit position relative to the nick generated by the engRNA complex
- the orientation of the tpgRNA target with respect to the engRNA target
- the distance between the two targets
engRNAs are preferentially selected when their DeepWT predicted efficiency score is > 0.3 (http://www.deephf.com/#/cas9).
DeepWT performed best among WT Cas9 predictors in Supplementary Fig. 9 of Tálas et al.
(Nucleic Acids Research, 2020; https://doi.org/10.1093/nar/gkaa1220). The planner excludes engRNA
targets when the spacer contains four consecutive ‘U’ bases, when the RTT exceeds 60 nt, or
when the edit site is located more than 50 nt from the engRNA nick.
RTT & PBS
Because proPE is less sensitive than PE to PBS/RTT length, we recommend universally testing
17-nt PBS and 7-nt RHA (right homology arm) for substitutions, and 10-nt RHA for insertions,
deletions, or multi-bp edits. RTT–PBS sequences with four consecutive ‘U’ bases are
excluded. In substitution edits, the RHA length could be shortened to 5 nt to avoid the
occurrence of four consecutive ‘U’ bases.