The proPE Planner is an intuitive interface for the rational design of engRNA and tpgRNA sequences to facilitate precise modifications using proPE, a prime editing tool described in the publication “ProPE expands the prime editing window and enhances gene editing efficiency where prime editing is inefficient” by Krausz et al..

How to use

Valid input criteria

min 150 nt + edit + min 150 nt

Edits can be substitutions, deletions, insertions, or their combinations, and don't need to be continuous.

Example inputs

Replacement: G to C edit '(G/C)'

TTTGAAACAAGCACCGTGGGGCCTTTGAGTCATAGTCGTGTAGCGAGAAAGCGTATGCTATTACGAGGCAACGGATGGAGGTTTGTTCGTTGCCGTTCAGAGGGAATGGCTCGCCACTGAGACCGCGTACGGTGTGAGTACATCCGAGTA(G/C)ATGTATCCGAGGCTGTGTACTACAAACCTAGCTTCGAACAAAGTGCATAAGGCTGAGCTTGGAGATAAAACATCATAAGATATTCCACCACCCAATCTTTTGGACTAGCCAGACCCCCTATCCACGTTCATTGCTACAACCGATCCGCTT

Deletion: G deletion edit '(-G)'

TCAAAGTCCCCGACACCTTCCAACCCTCATCCTGAACCAGCTCTATGACCGATCTAAATTGCTACTTCGTCGCGACAGTCCGCATCGCAGGCGGGTCGCTGTACGGTGTTTTGGCGACCATCAGTAAATGGTTCTATTATCCTCGGAATG(-G)CAACTGCATCGTACTCGCGTTAGCTTATTATTTAAAGAGGAGCGTTCCAGACCGAAGGGAGGATCGCCGGGATTTGATACTAGTTAAGACTCTCGAAATCTACATCCTCAGTTATTCTCCATCCGCCTACCCGAGATTAACACCCGACAA

Insertion: T insertion edit '(+T)'

AAATACGCGAGTGGACAAGTGCCCTGTGGTCGTGGTCGCAACTTGAGACAATTGGTTAGCCGTTGAGCGTCTTGATGGGACGAGTTGGCCACTCGGTATTTTAACGGCTCTGACGTTGGTACACAGCTTATATATGCTGGTCCGTGTGGT(+T)GATAGTCGGTTTGAATAGCCTACATCCCGTATTAACCATCACCGAGCCCCTTTACCCTGTGGCCCAATCTGCATTGAGAAATAGTCGTCGAAATGTAATCTATTAGACCTTGGACGGTTTACGAAAGCCCGACTCAGACGTCTGATGGCA

About the results

The planner outputs the spacers of engRNA–tpgRNA pairs, where targets are chosen by rational design rules. For each pair, it also suggests the RTT and PBS sequences at the 3′ end of the tpgRNA to achieve the requested edit.

Spacers

Targets for the engRNA–tpgRNA spacer pairs are ranked (1 = best) based on:

• the edit position relative to the nick generated by the engRNA complex
• the orientation of the tpgRNA target with respect to the engRNA target
• the distance between the two targets

engRNAs are preferentially selected when their DeepWT predicted efficiency score is > 0.3 (http://www.deephf.com/#/cas9). DeepWT performed best among WT Cas9 predictors in Supplementary Fig. 9 of Tálas et al. (Nucleic Acids Research, 2020; https://doi.org/10.1093/nar/gkaa1220). The planner excludes engRNA targets when the spacer contains four consecutive ‘U’ bases, when the RTT exceeds 60 nt, or when the edit site is located more than 50 nt from the engRNA nick.

RTT & PBS

Because proPE is less sensitive than PE to PBS/RTT length, we recommend universally testing 17-nt PBS and 7-nt RHA (right homology arm) for substitutions, and 10-nt RHA for insertions, deletions, or multi-bp edits. RTT–PBS sequences with four consecutive ‘U’ bases are excluded. In substitution edits, the RHA length could be shortened to 5 nt to avoid the occurrence of four consecutive ‘U’ bases.